Primer sequences for RT-PCR

Vps13bSense primer (5′→3′)Antisense primer (5′→3′)Product size (bp)
Exon 1–41:TCCAGCCTCTCTGCCTACTC5:CGGGGTTTTATGGATGATTTT424 bp (intact)268 bp (del)
Exon 2–32:CGAGTTAAAGTTGGACGTTCTGG3:AGGTTCGGAGCCCAATTTTGT115 bp
Exon 3–44:AGTGGCCATATCCATGAACTG5:CGGGGTTTTATGGATGATTTT194 bp
Exon 22–236:CAGTAAAGAGTCTCACGCTACAG7:TGTTCCAGGGATGTCACCAGA110 bp
Exp Neurobiol. 2019;28:485~494 https://doi.org/10.5607/en.2019.28.4.485
© Exp Neurobiol